View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11767_low_12 (Length: 386)
Name: NF11767_low_12
Description: NF11767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11767_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 318; Significance: 1e-179; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 318; E-Value: 1e-179
Query Start/End: Original strand, 7 - 369
Target Start/End: Original strand, 37340781 - 37341149
Alignment:
| Q |
7 |
tcgagtgagatgaaggtccaactatgtatgtgaaatgtgaactacaattggctaaataatgatatatttttggtcaactggattattaattatatgatta |
106 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
37340781 |
tcgagtgagcggaaggtccaactatgtatgtgaaatgtgaactacaattggctaaataatgatatttttttggtcaactggattattaattatatgatta |
37340880 |
T |
 |
| Q |
107 |
gcattgtcaaccagcctcacatgtcaaaaaacaatctagtacaacataccatgtgctttcatgcttgtttcctgtctttcttttagccctttct------ |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37340881 |
gcattgtcaaccagcctcacatgtcaaaaaacaatctagtacaacataccatgtgctttcatgcttatttcctgtctttcttttagccctttctttagtc |
37340980 |
T |
 |
| Q |
201 |
ttagtcttgcagatctgatattaactttgcgccttgtggctaaactatatccatgtcatatggcaaccatttattcatctccccccaagctaagtacaaa |
300 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37340981 |
ttagtcttgcaggtctgatattaactttgcgccttgtggctaaactatatccatgtcatatggcaaccatttattcatctccccccaagctaagtacaac |
37341080 |
T |
 |
| Q |
301 |
aacaacaataatattagaccgaccgccttgagctgaactatatggatctgggttatgtgcaattacaat |
369 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37341081 |
aacaataataatattagaccgaccgccttgagctgaactatatggatctgggttatgtgcaattacaat |
37341149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University