View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11767_low_24 (Length: 233)
Name: NF11767_low_24
Description: NF11767
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11767_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 17 - 207
Target Start/End: Complemental strand, 56020076 - 56019886
Alignment:
| Q |
17 |
agagaacgtccaaccattggtgaaattgttgatgcactaaaatacttatcttccaagagtacctctaaagtctataaacatggggtgcgtagctaaccgt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||| |
|
|
| T |
56020076 |
agagaacgtccaaccattggtgaaattgttgatgcactaaaatacttatcttccaagagtacctctaaagtctataaacatgggttgcgcagctaaccgt |
56019977 |
T |
 |
| Q |
117 |
tgcaaccacatttcaaaccagacagaagttaatttacataggtataagattctaggttgtttttcatttatgttcatgctttagatttttg |
207 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
56019976 |
tgcaaccacatttcaaaccagacagaagttaatatacttaggtataagattctaggttgtttttcatttatgttcatgctttagatttttg |
56019886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 39; Significance: 0.0000000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 39; E-Value: 0.0000000000003
Query Start/End: Original strand, 117 - 203
Target Start/End: Complemental strand, 6155705 - 6155619
Alignment:
| Q |
117 |
tgcaaccacatttcaaaccagacagaagttaatttacataggtataagattctaggttgtttttcatttatgttcatgctttagatt |
203 |
Q |
| |
|
||||||||||||||||| ||||| | |||| || |||||| || ||||||||||||||||||||||||||| |||| ||| |||| |
|
|
| T |
6155705 |
tgcaaccacatttcaaattagacatagattaaatttcataggcattagattctaggttgtttttcatttatgtccatgattttgatt |
6155619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University