View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11768_high_22 (Length: 469)
Name: NF11768_high_22
Description: NF11768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11768_high_22 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 252; Significance: 1e-140; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 252; E-Value: 1e-140
Query Start/End: Original strand, 1 - 358
Target Start/End: Original strand, 51522569 - 51522917
Alignment:
| Q |
1 |
gattctttgaattttccttgtttatttatttattttgaaaatccatgatttatgtaattgattctcgctgcatggtttgcgatgtcatctgcaatttttg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51522569 |
gattctttgaattttccttgtttatttatttattttgaaagtccatgatttatgtaattgattctcgctgcatggtttgcgatgtcatctgcaatttttg |
51522668 |
T |
 |
| Q |
101 |
ttgtcatgcacacatcctttctccttgcttctcatggaatcaattcatttgaaaacccaaaccttctctggaatcaaatgcaacgatttcgacgtcgctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
51522669 |
ttgtcatgcacacatcctttctccttgcttctcatggaatcaatt--tttgaaaacccaaaccttctctagaatcaaatgcaacgatttcgacgtcgctc |
51522766 |
T |
 |
| Q |
201 |
cactatctgttgagaatcattaccttgtggtttaagatagtgaaattcgataacagagaggaagaagagagaaatattttggt-gagannnnnnnnnnnn |
299 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
51522767 |
cactatctgttgagaatcattgccttgtggtttaagatagtgaagtttgataacagagaggaagaagagagaaatattttggtagagattttttttt--- |
51522863 |
T |
 |
| Q |
300 |
nnnnngacaagattttggtagagaatttatcattagatccagtagagtttcattgtgtg |
358 |
Q |
| |
|
||||| ||||||||||| |||||||||||||||||| ||||||||||||||||| |
|
|
| T |
51522864 |
-----gacaaaattttggtagataatttatcattagatccaatagagtttcattgtgtg |
51522917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University