View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11768_high_45 (Length: 305)
Name: NF11768_high_45
Description: NF11768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11768_high_45 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 62 - 301
Target Start/End: Original strand, 38603531 - 38603771
Alignment:
| Q |
62 |
gagagtaaaagtgaggttgtcgttttgtggtcacacgtggttggcttaaggttggcaaatgacatgtggtgataagggg-aaaaaacagaactttagagg |
160 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
38603531 |
gagagtaaaagtgaggttgtcgttttgtggtcacacgtggttggcttaaggttggcaaatgacatgtggtgataagggggaaaaaacagaactttagagg |
38603630 |
T |
 |
| Q |
161 |
aaagaaggaagtggaggaatgtgacgtttactcaacgaaacgcggtgtgagtgagtaatataagcaatttggtacagagaatttagcagtgtaagatggg |
260 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
38603631 |
aaagaaggaagtggaggaatgtgacgtttacttaacgaaacgcggtgtgagtgagtaatataagcaatttggtacagagaatttagcagtgtaagatgag |
38603730 |
T |
 |
| Q |
261 |
cgatgtgtggatctacgtcaacaaatgacatcttcttttgg |
301 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38603731 |
tgatgtgtggatctacgtcaacaaatggcatcttcttttgg |
38603771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University