View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11768_high_59 (Length: 242)
Name: NF11768_high_59
Description: NF11768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11768_high_59 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 4091745 - 4091969
Alignment:
| Q |
1 |
ggagttttggtgaaagaagttttaggtactgaacaagttctgcatttgcactggagtggttctgcatccacaatattggaaacgtgttcacgatattatg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4091745 |
ggagttttggtgaaagaagttttaggtactgaacaagttctgcatttgcactggagtggttctgcatccacaatattggaaacgtgttcacgatattatg |
4091844 |
T |
|
| Q |
101 |
atggtcaaggagaatgtcatgccatgggaaatc-agaaaataaaatttgtgcagaaaatcatagagatggagggaagtggcctcaaaccaattgcatttg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4091845 |
atggtcaaggagaatgtcatgccatgggaaatcaagaaaataaaatttgtgcagaaaatcatagagatggagggaagtggcctcaaaccaattgcatttg |
4091944 |
T |
|
| Q |
200 |
cttatagaaaaacgtatttgcaggt |
224 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
4091945 |
cttatagaaaaacgtatttgcaggt |
4091969 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 56; Significance: 2e-23; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 30 - 145
Target Start/End: Complemental strand, 42593004 - 42592889
Alignment:
| Q |
30 |
tgaacaagttctgcatttgcactggagtggttctgcatccacaatattggaaacgtgttcacgatattatgatggtcaaggagaatgtcatgccatggga |
129 |
Q |
| |
|
|||||||||| |||| |||||||||||||| ||||||||||||||||||||| |||||||| || || ||| | |||||| |||||||| |||||| | |
|
|
| T |
42593004 |
tgaacaagttatgcacttgcactggagtggggctgcatccacaatattggaaatgtgttcacagtactacgataggcaaggaaaatgtcattccatggaa |
42592905 |
T |
|
| Q |
130 |
aatcagaaaataaaat |
145 |
Q |
| |
|
||||||||||| |||| |
|
|
| T |
42592904 |
aatcagaaaatcaaat |
42592889 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University