View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11768_low_67 (Length: 230)
Name: NF11768_low_67
Description: NF11768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11768_low_67 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 156; Significance: 5e-83; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 156; E-Value: 5e-83
Query Start/End: Original strand, 62 - 225
Target Start/End: Complemental strand, 37058399 - 37058236
Alignment:
| Q |
62 |
aaaggttaattatttccaattgatcaaggggaatgtagaaaaaaccatgaagcatattaaattttttgggtataaaagtatttccgacagacaatgtata |
161 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37058399 |
aaaggttaattatttccaattcatcaaggggaatgtagaaaaaaccatgaagcatattaaaatttttgggtataaaagtatttccgacagacaatgtata |
37058300 |
T |
|
| Q |
162 |
ttttgcataggattctcactattttttctcttcacccctttgcttcttgtcccatatactctgt |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37058299 |
ttttgcataggattctcactattttttctcttcacccctttgcttcttgtcccatatactctgt |
37058236 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University