View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11768_low_70 (Length: 221)
Name: NF11768_low_70
Description: NF11768
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11768_low_70 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 14 - 204
Target Start/End: Complemental strand, 6620934 - 6620741
Alignment:
| Q |
14 |
gagaagcaagactcccatggtggaaataaaggtttaaaggttgaccccgacaaaaccaaaaaagtgatacgggaagagttgcaggaagtatagaatgaga |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6620934 |
gagaagcaagactcccatggtggaaataaaggtttaaaggttgaccccgacaaaaccaaaaaagtgatacgggaagagttgcaggaagtatagaatgaga |
6620835 |
T |
|
| Q |
114 |
gcaacgttgaatggaaaataaatgcatat-gatggattg--aacaaaagtagaggagactcatggccagatggatggtcccgaggcttggggtg |
204 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6620834 |
gcaacgttgaatggaaaataaatgcatatcgatggattgaaaacaaaagtagaggagactcatggccagatggatggtcccgaggcttggggtg |
6620741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University