View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11769_high_12 (Length: 350)
Name: NF11769_high_12
Description: NF11769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11769_high_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 286; Significance: 1e-160; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 286; E-Value: 1e-160
Query Start/End: Original strand, 36 - 342
Target Start/End: Complemental strand, 37337157 - 37336849
Alignment:
| Q |
36 |
cttccaataaaatgagttctttttgacggttattttcttgaacgtatcaaaaaccaaacaagaaattttgttaaatgagtttggtttgtactcaaagaag |
135 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37337157 |
cttccaacaaaatgagttctttttgacggttattttcttgaacgtatcaaaaaccaaacaagaaattttgttaaatgagtttggtttgtactcaaagaag |
37337058 |
T |
|
| Q |
136 |
atagtccaaatgagggaatgaagaaaaagatgtatggtatgagagaagaaggagacagtaaatggtttgcgtaaaaaacactcaaaatttggaaagagca |
235 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37337057 |
atagtccaaatgagggaatgaagaaaaagatgtatggtatgagagaagaaggagacagtaaatggtttgcgtaaaaaacactcaaaatttggaaagagca |
37336958 |
T |
|
| Q |
236 |
gggaggaagaaaataaatgtgcatctcctcactcgtggggtgaaaattaaataacaagattcattt--gttttagaggaaactaacaagattcattattc |
333 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
37336957 |
gggaggaagaaaataaatgtgcatctcctcactcgtggggtgaaaattaaataacaagattcattttatttttagaggaaactaacaagattcattattc |
37336858 |
T |
|
| Q |
334 |
atctcactc |
342 |
Q |
| |
|
|| |||||| |
|
|
| T |
37336857 |
atttcactc |
37336849 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University