View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11769_high_17 (Length: 269)
Name: NF11769_high_17
Description: NF11769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11769_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 56 - 261
Target Start/End: Original strand, 4187806 - 4188012
Alignment:
| Q |
56 |
gttcatcttcatagttgaagtgtgggatatagtgcaatgtttagtttttgtctgttcgatttccttatgcggcaatggatatttctactacataacaatt |
155 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4187806 |
gttcatcttcatagttgaagtgtgggatatagtgcaatgtttagtttttgtctgttcgatttccttatgcggcaatggatatttgtactacataacaatt |
4187905 |
T |
|
| Q |
156 |
tgtgttatgccttcatcgtcgtttggagc-nnnnnnnntgtactatatgttaaattaaaattctttgaaatgannnnnnnnctttccatttcctggctcc |
254 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
4187906 |
tgtgttatgccttcatcgtcgtttggagcaaaaaaatatgtactatattttaaattaaaattctttgaaatgattttttttctttccatttcctggctcc |
4188005 |
T |
|
| Q |
255 |
ctatgct |
261 |
Q |
| |
|
|||||| |
|
|
| T |
4188006 |
ttatgct |
4188012 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 116 - 167
Target Start/End: Original strand, 4196700 - 4196751
Alignment:
| Q |
116 |
ttccttatgcggcaatggatatttctactacataacaatttgtgttatgcct |
167 |
Q |
| |
|
||||||||| ||| |||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4196700 |
ttccttatgtggccatggatatttctacaacataacaatttgtgttatgcct |
4196751 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University