View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11769_high_25 (Length: 236)
Name: NF11769_high_25
Description: NF11769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11769_high_25 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 236
Target Start/End: Original strand, 5015409 - 5015645
Alignment:
| Q |
1 |
ggttggcaggataaattcttatatcttcagcaggtcgcgaggtgctcattaaatctcttgcgtagtccattcttacaaacacatatcatggatcgtttcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5015409 |
ggttggcaggataaattcttatatcttcagcaggtcgcgaggtgctcattaaatctcttgcgtagtccattcttacaaacacatatcatggatcgtttcc |
5015508 |
T |
 |
| Q |
101 |
tcttatccagatatgattatttgatgatattgtagcaatgataaagcaattttgatgtggttatagttacaataaaa-tacgctagctcaactgaaacaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
5015509 |
tcttatccagatatgattatttgatgatattgaagcaatgataaagcaattttgatgtggttatagttacaataaaattacgctagctcaactgaaacaa |
5015608 |
T |
 |
| Q |
200 |
atgttgtaaaccttaaagtatatgaggaatgaggttt |
236 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
5015609 |
atgttgtaaaccttaacgtatatgaggaatgaggttt |
5015645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University