View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11769_low_25 (Length: 241)
Name: NF11769_low_25
Description: NF11769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11769_low_25 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 10 - 226
Target Start/End: Original strand, 43828619 - 43828832
Alignment:
| Q |
10 |
gcagagattttgcattgcatggctctgtagctagttaactgaatatgagaggaataatgggaacttctcctcgttctgttgaagctagacatcgtttgcc |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43828619 |
gcagagattttgcattgcatggctctgtagctagttaattgaatatgagaggaataatgggaacttctcctcgttctgttgaagctagacatcgtttgcc |
43828718 |
T |
 |
| Q |
110 |
ttcatccatgtgagttccttaattttgttcttcattcccaccttttcttagttctatatgctgcaaagagttatgtttaatttctcttaaatcaagtttc |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43828719 |
ttcatccatgtgagttccttaattttgttcttcattcccaccttttcttagttctata---tgcaaagagttatgtttaatttctcttaaatcaagtttc |
43828815 |
T |
 |
| Q |
210 |
ataaatgatggataaat |
226 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
43828816 |
ataaatgatggataaat |
43828832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University