View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11769_low_28 (Length: 206)
Name: NF11769_low_28
Description: NF11769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11769_low_28 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 168; Significance: 3e-90; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 25 - 200
Target Start/End: Complemental strand, 50301691 - 50301516
Alignment:
| Q |
25 |
gaagcaattaagcgttaattctctatctcttgcaagagcattcatttcctaagctggtccccgatacttctatgatcatcctgtatcgattgagcgattt |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
50301691 |
gaagcaattaagcgttaattctctatctcttgcaagagcattcatttcctaagctggtccccgttacttctatgatcatcctgtatcgattgagcgattt |
50301592 |
T |
 |
| Q |
125 |
tttattaatgaaatgatgatggactacaatatctttttattagcaccgttgcttaatgattaaaacaccacattcg |
200 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50301591 |
tttattaatgaaatgatgatgaactacaatatctttttattagcaccgttgcttaatgattaaaacaccacattcg |
50301516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University