View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11769_low_8 (Length: 422)
Name: NF11769_low_8
Description: NF11769
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11769_low_8 |
 |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 168; Significance: 7e-90; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 168; E-Value: 7e-90
Query Start/End: Original strand, 233 - 412
Target Start/End: Complemental strand, 47917294 - 47917115
Alignment:
| Q |
233 |
gaagcgaggcttggtaccgatatgggcttagaacagcagcaggtatcgtaatcttccttgttagtggcctctattgtcggctcatcaattcacttggctc |
332 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
47917294 |
gaagcgaggcttggtaccgatatgggcttagaacagcagcaggtatcttaatcttccttgttagtggcctccattgtcggctcatcaattcacttggctc |
47917195 |
T |
 |
| Q |
333 |
agaaacatgaccatcttttccatttcccaagtccccttcctttggccacattgcattaccaaaaccatatgtcccctttg |
412 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47917194 |
agaaacatgaccatcttttccatttcccaaatccccttcctttggccacattgcattaccaaaaccatatgtcccctttg |
47917115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 93; E-Value: 4e-45
Query Start/End: Original strand, 71 - 167
Target Start/End: Complemental strand, 47917456 - 47917360
Alignment:
| Q |
71 |
aaaacttatatccatcaattacattcaagttggtcaaatatagtgaagccaaaatgatcattcataataaaggggaaatgcatgattttgatcacta |
167 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47917456 |
aaaacttatatccatcaattacattcaagttggtcaaatatagtgaagccaaaatggtcattcataataaaggggaaatgcatgattttgatcacta |
47917360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 119; Significance: 1e-60; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 1e-60
Query Start/End: Original strand, 238 - 412
Target Start/End: Original strand, 29919985 - 29920159
Alignment:
| Q |
238 |
gaggcttggtaccgatatgggcttagaacagcagcaggtatcgtaatcttccttgttagtggcctctattgtcggctcatcaattcacttggctcagaaa |
337 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| | | ||||||||||||||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
29919985 |
gaggcttggtaccgatatgggctgagaacagcagcaggtatcttcaacttccttgttagtggcctccatggtcggctcatcaattcagttggctcagaaa |
29920084 |
T |
 |
| Q |
338 |
catgaccatcttttccatttcccaagtccccttcctttggccacattgcattaccaaaaccatatgtcccctttg |
412 |
Q |
| |
|
||| ||||||||||||||||| || || |||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
29920085 |
catcgccatcttttccatttccgaaatctccttcctttggccatattgcattaccataaccatatgtcccctttg |
29920159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 92 - 167
Target Start/End: Original strand, 29919828 - 29919903
Alignment:
| Q |
92 |
cattcaagttggtcaaatatagtgaagccaaaatgatcattcataataaaggggaaatgcatgattttgatcacta |
167 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||| ||| ||| |||||||||||| ||||||| ||||||||||| |
|
|
| T |
29919828 |
cattcaaattggtcaaatatagtgaagccaaaatggtcaatcagaataaaggggaagtgcatgactttgatcacta |
29919903 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 243 - 279
Target Start/End: Original strand, 53929 - 53965
Alignment:
| Q |
243 |
ttggtaccgatatgggcttagaacagcagcaggtatc |
279 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
53929 |
ttggtaccgatatgggctgagaacagcagaaggtatc |
53965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University