View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1176_low_13 (Length: 399)
Name: NF1176_low_13
Description: NF1176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1176_low_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 8e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 8e-74
Query Start/End: Original strand, 1 - 149
Target Start/End: Original strand, 40429025 - 40429173
Alignment:
| Q |
1 |
ttatgacatgttttacatggtacgtgacttgtttgtggcttgaacgagtgaagtggcgattttgtctctctgccatgacaacgcaaccatgcattgcatt |
100 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40429025 |
ttatgacatgttttacatggtgtgtgacttgtttgtggcttgaacgagtgaagtggcgattttgtctctctgccatgacaacgcaaccatgcattgcatt |
40429124 |
T |
 |
| Q |
101 |
gcacttcatctttctcttcctatccatatcaggtatcttctcattctcc |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40429125 |
gcacttcatctttctcttcctatccatatcaggtatcttctcattctcc |
40429173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 123; E-Value: 4e-63
Query Start/End: Original strand, 218 - 391
Target Start/End: Original strand, 40429242 - 40429413
Alignment:
| Q |
218 |
tattgttatagcattagaaatggaggaaaaatcaatcactaaatgggtttagcttaaattattgnnnnnnnnnnatttataattttagttgtgatatcaa |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
40429242 |
tattgttatagcattagaaatggaggaaaaatcaatcactaaatgggtttagcttaaattattgttttttttt-atttataattttacttgtgatatcaa |
40429340 |
T |
 |
| Q |
318 |
tggcaaagttctcattttaatgtgtttgtttccaacttttatttctcttaatagttctggatgaagcctatgat |
391 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
40429341 |
tggcaa-gttctcattttaatgtgtttgtttccaacttttatttctcttaatagttctggatgaagcttatgat |
40429413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University