View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1176_low_17 (Length: 325)
Name: NF1176_low_17
Description: NF1176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1176_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 72 - 318
Target Start/End: Complemental strand, 27900817 - 27900569
Alignment:
| Q |
72 |
gtgtgagtcaactttatcaagtttgtgtaaaataacaacattagaatatagcaatcgagaatcaatttaggt-gatatgttggttcgaagattttggcta |
170 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||| |||||||| |||||||||||| || ||| ||||||||||||||||||||||| |
|
|
| T |
27900817 |
gtgtgagtcaactttatcaagtttgtgtaaaataacaacattaaaatgtagcaatcaagaatcaatttacgttgatctgttggttcgaagattttggcta |
27900718 |
T |
|
| Q |
171 |
tgtttcatgttggtcttagtttgtggtttcagatgggcttgtcggaggttttatgttttt-ccggatattagattagaacaccgcctttctgtttttaac |
269 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||||||| |||||||||| ||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27900717 |
tgtttcatgttggtctcggtttgtggtttcagttgggcttgccggaggttttgtgttttttccggatattagattagaacaccgcctttctgtttttaac |
27900618 |
T |
|
| Q |
270 |
gggcggtctttgtttctgttttgtttttgctggtgggttgtctgtggtg |
318 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27900617 |
ggacggtctttgtttctgttttgtttttgctggtgggttgtcggtggtg |
27900569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University