View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1176_low_18 (Length: 317)
Name: NF1176_low_18
Description: NF1176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1176_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 9 - 289
Target Start/End: Original strand, 41338295 - 41338573
Alignment:
| Q |
9 |
agcagagaccgatatatttcagacaaaagctatcttcatgtctttgtgtcgtcatcacgtaggttgtaacatgggttgccctttcattccaaaaatgtcg |
108 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41338295 |
agcagagaccgatatatttcagacaaaagctatcttcatgtct--gtgtcgtcatcacgtaggttgtaacatgggttgccctttcattccaaaaatgtcg |
41338392 |
T |
 |
| Q |
109 |
gtttgtgattgcnnnnnnncgttttgagggttatgaaggaaaataactaaagaagtaaagagaaatgtgtgggttaaatttgaagatgttatggtacgaa |
208 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41338393 |
gtttgtgattgcaaaaaaacgttttgagggttatgaaggaaaataactaaagaagtaaagagaaatgtgtgggttaaatttgaagatgttatggtacgaa |
41338492 |
T |
 |
| Q |
209 |
ttatgaatctactagggctcaaaaattcatgcaaaataataatgcttcgtgaaatgaaatggcattggatttgctttatgt |
289 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41338493 |
ttatgaatctactagggctcaaaaattcatgcaaaataataatgcttcgtgaaatgaaatggcattggatttgctttatgt |
41338573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University