View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1176_low_21 (Length: 308)
Name: NF1176_low_21
Description: NF1176
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1176_low_21 |
 | |
|
| [»] scaffold0332 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0332 (Bit Score: 214; Significance: 1e-117; HSPs: 1)
Name: scaffold0332
Description:
Target: scaffold0332; HSP #1
Raw Score: 214; E-Value: 1e-117
Query Start/End: Original strand, 37 - 250
Target Start/End: Original strand, 10035 - 10248
Alignment:
| Q |
37 |
gtttgttcatccaaccaaaacagaagcatggaagcacactttcttttcaaaagacaagggttcgatgtatcttcttatggaacaggtacccacgttaagc |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10035 |
gtttgttcatccaaccaaaacagaagcatggaagcacactttcttttcaaaagacaagggttcgatgtatcttcttatggaacaggtacccacgttaagc |
10134 |
T |
|
| Q |
137 |
tcccaggtccttccctcagagaaccaaatgtctatgaatttggaactccttacaaatacatgcttgatgagcttcgtagaaaagaccctgaactgtatcc |
236 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10135 |
tcccaggtccttccctcagagaaccaaatgtctatgaatttggaactccttacaaatacatgcttgatgagcttcgtagaaaagaccctgaactgtatcc |
10234 |
T |
|
| Q |
237 |
ttttgttatttgcc |
250 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
10235 |
ttttgttatttgcc |
10248 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University