View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11770_low_3 (Length: 241)

Name: NF11770_low_3
Description: NF11770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11770_low_3
NF11770_low_3
[»] chr6 (1 HSPs)
chr6 (176-236)||(14721984-14722044)
[»] chr5 (1 HSPs)
chr5 (176-228)||(39465207-39465259)


Alignment Details
Target: chr6 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 176 - 236
Target Start/End: Complemental strand, 14722044 - 14721984
Alignment:
176 tgtaaagtgatgttcatagatggtcaaatttagtggggttagcaaaaatgttgatgtccat 236  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14722044 tgtaaagtgatgttcatagatggtcaaatttagtggggttagcaaaaatgttgatgtccat 14721984  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 176 - 228
Target Start/End: Original strand, 39465207 - 39465259
Alignment:
176 tgtaaagtgatgttcatagatggtcaaatttagtggggttagcaaaaatgttg 228  Q
    |||||||| ||||||||| ||||||| ||||||||| ||||||||||||||||    
39465207 tgtaaagtaatgttcatatatggtcagatttagtggagttagcaaaaatgttg 39465259  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University