View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11770_low_3 (Length: 241)
Name: NF11770_low_3
Description: NF11770
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11770_low_3 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 176 - 236
Target Start/End: Complemental strand, 14722044 - 14721984
Alignment:
| Q |
176 |
tgtaaagtgatgttcatagatggtcaaatttagtggggttagcaaaaatgttgatgtccat |
236 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14722044 |
tgtaaagtgatgttcatagatggtcaaatttagtggggttagcaaaaatgttgatgtccat |
14721984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 37; Significance: 0.000000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 37; E-Value: 0.000000000005
Query Start/End: Original strand, 176 - 228
Target Start/End: Original strand, 39465207 - 39465259
Alignment:
| Q |
176 |
tgtaaagtgatgttcatagatggtcaaatttagtggggttagcaaaaatgttg |
228 |
Q |
| |
|
|||||||| ||||||||| ||||||| ||||||||| |||||||||||||||| |
|
|
| T |
39465207 |
tgtaaagtaatgttcatatatggtcagatttagtggagttagcaaaaatgttg |
39465259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University