View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11771_high_12 (Length: 258)
Name: NF11771_high_12
Description: NF11771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11771_high_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 183; Significance: 4e-99; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 47 - 241
Target Start/End: Original strand, 1751681 - 1751875
Alignment:
| Q |
47 |
tatatataatagcaatgaaccaatgttacgagttaaagggttccataagaaattgctatataagttttgaaatctatgttgtgtaccaaatgtaaattag |
146 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1751681 |
tatatataatagcaatgaaccaatgttacgagttaaagggttccataagaaattgctatataagttttgaaatctatgttgtgtaccaaatgtaaattag |
1751780 |
T |
 |
| Q |
147 |
aagttttattggtattttttaagtaagataatctataaacacaatgtctttcggttttggattaatgatgtggtatcgaactcatttgtgtggtt |
241 |
Q |
| |
|
|||||||||||||||||| ||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1751781 |
aagttttattggtattttctaagtaagagaatctataaacacactgtctttcggttttggattaatgatgtggtatcgaactcatttgtgtggtt |
1751875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University