View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11771_low_12 (Length: 294)
Name: NF11771_low_12
Description: NF11771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11771_low_12 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 104; Significance: 7e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 104; E-Value: 7e-52
Query Start/End: Original strand, 169 - 272
Target Start/End: Original strand, 42929751 - 42929854
Alignment:
| Q |
169 |
atagcactcgttgtgtttcttgttcggaagctcgcgaggaagaggttgatactcctagttcttctttgttgttagaacaagttagggaggagattgattg |
268 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42929751 |
atagcactcgttgtgtttcttgttcggaagctcgcgaggaagaggttgatactcctagttcttctttgttgttagaacaagttagggaggagattgattg |
42929850 |
T |
|
| Q |
269 |
tgaa |
272 |
Q |
| |
|
|||| |
|
|
| T |
42929851 |
tgaa |
42929854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 19 - 72
Target Start/End: Original strand, 42929601 - 42929654
Alignment:
| Q |
19 |
atcatggctatattgttggtgcttttgttgatttattggttggtcttacatttg |
72 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42929601 |
atcatggctatattgttggtgcttttgttgatttattggttggtcttacatttg |
42929654 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University