View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11771_low_15 (Length: 250)

Name: NF11771_low_15
Description: NF11771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11771_low_15
NF11771_low_15
[»] chr7 (2 HSPs)
chr7 (35-197)||(23383879-23384041)
chr7 (189-236)||(23383451-23383498)


Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 35 - 197
Target Start/End: Complemental strand, 23384041 - 23383879
Alignment:
35 aactaagtaaacaattgtaggcgttggatccggttactaagttgcaaaagagaaggaagtcaaacatgacctaatctctcttttaattgtttttacttcg 134  Q
    |||||||||||||||||||||| ||||| ||| |||| ||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||    
23384041 aactaagtaaacaattgtaggccttggacccgattaccaagttgccaaagagaaggaagtcaaacatgacctaatctcccttttaattgtttttacttcg 23383942  T
135 ttaaagtgaaccaatcattgttaagtgcaaccccccaattaaaacatccgaattataatcata 197  Q
    |||||||||||||||||||| ||||||||||| | ||||||||||||| ||||||||||||||    
23383941 ttaaagtgaaccaatcattgctaagtgcaaccgcacaattaaaacatctgaattataatcata 23383879  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 189 - 236
Target Start/End: Complemental strand, 23383498 - 23383451
Alignment:
189 ataatcatattggttgagtagaaattttacaattcttatggtgacaaa 236  Q
    ||||||||||||| |||||||||||||||||||||||||| |||||||    
23383498 ataatcatattggctgagtagaaattttacaattcttatgatgacaaa 23383451  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University