View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11771_low_15 (Length: 250)
Name: NF11771_low_15
Description: NF11771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11771_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 123; Significance: 3e-63; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 123; E-Value: 3e-63
Query Start/End: Original strand, 35 - 197
Target Start/End: Complemental strand, 23384041 - 23383879
Alignment:
| Q |
35 |
aactaagtaaacaattgtaggcgttggatccggttactaagttgcaaaagagaaggaagtcaaacatgacctaatctctcttttaattgtttttacttcg |
134 |
Q |
| |
|
|||||||||||||||||||||| ||||| ||| |||| ||||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
23384041 |
aactaagtaaacaattgtaggccttggacccgattaccaagttgccaaagagaaggaagtcaaacatgacctaatctcccttttaattgtttttacttcg |
23383942 |
T |
 |
| Q |
135 |
ttaaagtgaaccaatcattgttaagtgcaaccccccaattaaaacatccgaattataatcata |
197 |
Q |
| |
|
|||||||||||||||||||| ||||||||||| | ||||||||||||| |||||||||||||| |
|
|
| T |
23383941 |
ttaaagtgaaccaatcattgctaagtgcaaccgcacaattaaaacatctgaattataatcata |
23383879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 40; E-Value: 0.00000000000009
Query Start/End: Original strand, 189 - 236
Target Start/End: Complemental strand, 23383498 - 23383451
Alignment:
| Q |
189 |
ataatcatattggttgagtagaaattttacaattcttatggtgacaaa |
236 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
23383498 |
ataatcatattggctgagtagaaattttacaattcttatgatgacaaa |
23383451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University