View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11771_low_17 (Length: 241)
Name: NF11771_low_17
Description: NF11771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11771_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 113 - 223
Target Start/End: Original strand, 40465190 - 40465300
Alignment:
| Q |
113 |
ttacttcctcaatgatgataaagaatatnnnnnnnggataatgccaatgagaatctaaagggtgtaatatggaacatggagagaaagacaaaatggttca |
212 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40465190 |
ttacttcctcaatgatgataaagaatataaaaaaaggataatgccaatgagaatctaaagggtgtaatatggaacatggagagaaagacaaaatggttca |
40465289 |
T |
|
| Q |
213 |
gaaggataaac |
223 |
Q |
| |
|
||||||||||| |
|
|
| T |
40465290 |
gaaggataaac |
40465300 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 1 - 73
Target Start/End: Original strand, 40465078 - 40465150
Alignment:
| Q |
1 |
taaatattatgacaattattgttgaacgaattaaatattagatttatatggccaagcttaaatttatgatagg |
73 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40465078 |
taaatattatgacaattattgttgaacgaattaaatattagatttatatggccaagcttaaatttatgatagg |
40465150 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University