View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11771_low_24 (Length: 212)
Name: NF11771_low_24
Description: NF11771
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11771_low_24 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 1 - 199
Target Start/End: Complemental strand, 32861151 - 32860953
Alignment:
| Q |
1 |
acaagctaaggcctctgtgttcctgtgagttccaaattgggaatatggtgttggttaaattatagccttctcatcaacatggtgtcattgagccgcaatc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||| |
|
|
| T |
32861151 |
acaagctaaggcctctgtgttcctgtgagttccaaattgggaatatggtgttggttaaattatagccttctcgtcaacatggtgtcactgagccgtaatc |
32861052 |
T |
 |
| Q |
101 |
agaaacttgtttatgctacttcggtcccttcccagtcattgagaaaatgggatcagttacatataaattgttgctgccatcagctgctaaaatacatct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32861051 |
agaaacttgtttatgctacttcggtcccttcccagtcattgagaaaatgggatcagttacatataaattgttgctgccatcagctgctaaaatacatct |
32860953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University