View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11773_high_12 (Length: 281)
Name: NF11773_high_12
Description: NF11773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11773_high_12 |
 |  |
|
| [»] scaffold0078 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr1 (Bit Score: 181; Significance: 7e-98; HSPs: 12)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 43 - 268
Target Start/End: Complemental strand, 4956216 - 4955991
Alignment:
| Q |
43 |
ttgcacacaatagaactacatgctacaacctatatttcctttctctacttttttagaactgcatgcaagttctaagaacttaccagaaatctttgttgcn |
142 |
Q |
| |
|
||||||||||||||||||| |||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4956216 |
ttgcacacaatagaactacctgctgccacctatatttcctttctctacttttttagaactgcatgcaagttctaagaacttaccagaaatctttgttgca |
4956117 |
T |
 |
| Q |
143 |
nnnnnngtttaataaaagcaagagttgtcatcttttgacctaaaaactagattagacaaattaataatacttaactttaatttttgaaaaagaataatca |
242 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4956116 |
aaaaaagtttaataaaagcaagagttgtcatcttttgacctaaaaactagattagacaaattaataatacttaactttaatttttgaaaaagaataatca |
4956017 |
T |
 |
| Q |
243 |
tagacggatatagatatgaatttgat |
268 |
Q |
| |
|
|| || |||||||||||| ||||||| |
|
|
| T |
4956016 |
taaacagatatagatatggatttgat |
4955991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 22077607 - 22077658
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
22077607 |
aacctttacttttctatccgatgtgagacatataactcacacttgcacacaa |
22077658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 66584 - 66635
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||||||||||||||| || | |||||||||||| ||||||||||| |
|
|
| T |
66584 |
aacctttacttttctatccgatatggaacatataactcacacttgcacacaa |
66635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 39066312 - 39066363
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
||||||||||||||||||||||||| | ||||||||||| ||||||||||| |
|
|
| T |
39066312 |
aacctttacttttctatccgatgtggaatatataactcacacttgcacacaa |
39066363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 54
Target Start/End: Original strand, 22077940 - 22077993
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaata |
54 |
Q |
| |
|
|||||||| ||||||||||||| | || |||||||||||| ||||||||||||| |
|
|
| T |
22077940 |
aacctttatttttctatccgatttaaaacatataactcacacttgcacacaata |
22077993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 5 - 52
Target Start/End: Original strand, 5320081 - 5320128
Alignment:
| Q |
5 |
tttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
||||||||||||||||||||| | |||||||||||| |||||| |||| |
|
|
| T |
5320081 |
tttacttttctatccgatgtggaacatataactcacacttgcatacaa |
5320128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 24600426 - 24600477
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
24600426 |
aacctttacttttctatccgatatgggacatataactcacacttgcacacaa |
24600477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 34364553 - 34364502
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||| || |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
34364553 |
aacctttactattttatccgatgtgagacatataactcacacttgcacacaa |
34364502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 41184537 - 41184588
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||| || |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
41184537 |
aacctttactattttatccgatgtgagacatataactcacacttgcacacaa |
41184588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 44685502 - 44685451
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
44685502 |
aacctttacttttctatccgatatgggacatataactcacacttgcacacaa |
44685451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 66200 - 66252
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcat-ataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||| ||| || |||||| ||||||||||| |
|
|
| T |
66200 |
aacctttacttttctatccgatgtgagacatgattactcacacttgcacacaa |
66252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 1188707 - 1188751
Alignment:
| Q |
8 |
acttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
||||||||||||||| || | |||||||||||| ||||||||||| |
|
|
| T |
1188707 |
acttttctatccgatatggaacatataactcacacttgcacacaa |
1188751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 7)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 3244561 - 3244612
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
3244561 |
aacctttacttttctatccgatgtgagacatataactcacacttgcacacaa |
3244612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 54741288 - 54741339
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
54741288 |
aacctttacttttctatccgatgtgagacatataattcacacttgcacacaa |
54741339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 2740746 - 2740695
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
2740746 |
aacctttactgttctatccgatgtgggacatataactcacacttgcacacaa |
2740695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 10245966 - 10245915
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||| || ||||||||||| ||||||||||||| ||||||||||| |
|
|
| T |
10245966 |
aacctttactcttttatccgatgtggggcatataactcacacttgcacacaa |
10245915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 25483382 - 25483331
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||| || |||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
25483382 |
aacctttactattttatccgatgtgagacatataactcacacttgcacacaa |
25483331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 16888926 - 16888971
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgc |
46 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||| |
|
|
| T |
16888926 |
aacctttacttttctatccgatgtgggacatataactcacacttgc |
16888971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 46
Target Start/End: Original strand, 16889646 - 16889691
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgc |
46 |
Q |
| |
|
|||||||||||||||||||||| ||| |||||||||||| ||||| |
|
|
| T |
16889646 |
aacctttacttttctatccgatttgagacatataactcacacttgc |
16889691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0078 (Bit Score: 36; Significance: 0.00000000003; HSPs: 1)
Name: scaffold0078
Description:
Target: scaffold0078; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 5403 - 5352
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||| |||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
5403 |
aacctttactgttctatccgatgtggaacatataactcacacttgcacacaa |
5352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 36; Significance: 0.00000000003; HSPs: 4)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 41972204 - 41972153
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
41972204 |
aacctttacttttctatccgatgtgggacatataactcacacttgcacacaa |
41972153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 9608791 - 9608735
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaatagaa |
57 |
Q |
| |
|
|||||||||||||||||||||| || |||||||||||| ||||||||||| |||| |
|
|
| T |
9608791 |
aacctttacttttctatccgatatgggacatataactcacacttgcacacaacagaa |
9608735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 45122169 - 45122221
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaat |
53 |
Q |
| |
|
|||||||||| || |||||||||||| |||||||||||| |||||||||||| |
|
|
| T |
45122169 |
aacctttactattttatccgatgtgagacatataactcacacttgcacacaat |
45122221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 40518628 - 40518575
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaata |
54 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||| |||| |||||||| |
|
|
| T |
40518628 |
aacctttacttttctatctgatgtgggacatataactcacacttgaacacaata |
40518575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 36; Significance: 0.00000000003; HSPs: 6)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 5 - 52
Target Start/End: Original strand, 28301659 - 28301706
Alignment:
| Q |
5 |
tttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
28301659 |
tttacttttctatccgatgtgagacatataactcacacttgcacacaa |
28301706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 16569242 - 16569191
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||| |||||| |||| |
|
|
| T |
16569242 |
aacctttactgttctatccgatgtgagacatataactcacacttgcatacaa |
16569191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 16596420 - 16596471
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||| ||||||||||||||| |||||||||||| |||||| |||| |
|
|
| T |
16596420 |
aacctttactgttctatccgatgtgagacatataactcacacttgcatacaa |
16596471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 43241541 - 43241490
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||| |||| ||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
43241541 |
aacctttatttttttatccgatgtggaacatataactcacacttgcacacaa |
43241490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 1 - 54
Target Start/End: Complemental strand, 36623006 - 36622953
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaata |
54 |
Q |
| |
|
|||||||||| || ||||||||||| |||||||||||| ||||||||||||| |
|
|
| T |
36623006 |
aacctttactattttatccgatgtgggacatataactcacacttgcacacaata |
36622953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 4 - 52
Target Start/End: Original strand, 36967344 - 36967392
Alignment:
| Q |
4 |
ctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||||| |||| |||||| |
|
|
| T |
36967344 |
ctttacttttttatccgatgtgagacatataactcacacttgtacacaa |
36967392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 36; Significance: 0.00000000003; HSPs: 5)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 41632828 - 41632777
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||| || ||||||||||| |
|
|
| T |
41632828 |
aacctttacttttctatccgatgtgagacatataacttacacttgcacacaa |
41632777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 31509662 - 31509618
Alignment:
| Q |
8 |
acttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
31509662 |
acttttctatccgatgtgagacatataactcacacttgcacacaa |
31509618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 26074258 - 26074309
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
26074258 |
aacctttacttttttatccgatgtgtgacatataactcacacttgcacacaa |
26074309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 5 - 52
Target Start/End: Original strand, 36568683 - 36568730
Alignment:
| Q |
5 |
tttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
||||||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
36568683 |
tttacttttctatccgatgtgggacatataactcacacttgcacacaa |
36568730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 3 - 52
Target Start/End: Original strand, 1028631 - 1028680
Alignment:
| Q |
3 |
cctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |||| |||||| |
|
|
| T |
1028631 |
cctttacttttctatccgatgtgggacatataactcacacttgtacacaa |
1028680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 33; Significance: 0.000000002; HSPs: 7)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 47965034 - 47965078
Alignment:
| Q |
8 |
acttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
||||||||||||||||| || |||||||||||| ||||||||||| |
|
|
| T |
47965034 |
acttttctatccgatgtaaaacatataactcacacttgcacacaa |
47965078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 5 - 52
Target Start/End: Complemental strand, 9240191 - 9240144
Alignment:
| Q |
5 |
tttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
||||||| ||||||||||||| | |||||||||||| ||||||||||| |
|
|
| T |
9240191 |
tttacttctctatccgatgtggaacatataactcacacttgcacacaa |
9240144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 33175776 - 33175827
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||| |||| |||||| |
|
|
| T |
33175776 |
aacctttacttttctatctgatgtgagacatataactcacacttgtacacaa |
33175827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 49336799 - 49336850
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||||||||||||||||||| ||| |||||||| |||| |||||| |
|
|
| T |
49336799 |
aacctttacttttctatccgatgtgagacatgtaactcacacttgtacacaa |
49336850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 12747871 - 12747915
Alignment:
| Q |
8 |
acttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
12747871 |
acttttctatccgatgtgggacatataactcacacttgcacacaa |
12747915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 49
Target Start/End: Original strand, 21832455 - 21832503
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcaca |
49 |
Q |
| |
|
||||||||||||||||||| ||||| |||||||||||| |||||||| |
|
|
| T |
21832455 |
aacctttacttttctatccaatgtgggacatataactcacacttgcaca |
21832503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 11 - 55
Target Start/End: Original strand, 39336351 - 39336395
Alignment:
| Q |
11 |
tttctatccgatgtgaagcatataactcacccttgcacacaatag |
55 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
39336351 |
tttctatccgatgtgggacatataactcacacttgcacacaatag |
39336395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 5 - 52
Target Start/End: Original strand, 10074107 - 10074154
Alignment:
| Q |
5 |
tttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
10074107 |
tttacttttctatccgatgtgggatatataactcacccttgcacacaa |
10074154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 16107724 - 16107673
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||| |||| |||||| |
|
|
| T |
16107724 |
aacctttacttttttatccgatgtgacacatataactcacacttgtacacaa |
16107673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 32; Significance: 0.000000006; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Complemental strand, 962644 - 962593
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||| |||||| |||| |
|
|
| T |
962644 |
aacctttacttttctatccgatgtgggacatataactcacacttgcatacaa |
962593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 1 - 52
Target Start/End: Original strand, 28531426 - 28531477
Alignment:
| Q |
1 |
aacctttacttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
||||||| ||||||||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
28531426 |
aacctttgcttttctatccgatgtgggacatataactcacacttgcacacaa |
28531477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 52
Target Start/End: Complemental strand, 30313217 - 30313173
Alignment:
| Q |
8 |
acttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
||||||||||||||||||| |||||||| ||| ||||||||||| |
|
|
| T |
30313217 |
acttttctatccgatgtgagacatataacacacgcttgcacacaa |
30313173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 8 - 52
Target Start/End: Original strand, 33561570 - 33561614
Alignment:
| Q |
8 |
acttttctatccgatgtgaagcatataactcacccttgcacacaa |
52 |
Q |
| |
|
||||||||||| |||||| | |||||||||||| ||||||||||| |
|
|
| T |
33561570 |
acttttctatctgatgtggaacatataactcacacttgcacacaa |
33561614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University