View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11773_high_15 (Length: 246)
Name: NF11773_high_15
Description: NF11773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11773_high_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 23 - 239
Target Start/End: Complemental strand, 5543182 - 5542966
Alignment:
| Q |
23 |
atatcctccacaacaagtgcaagagattttgtcccctcaggtatgttgtaccattccaatggtggtgatatgtttttctttgctccttgtccttcatcag |
122 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5543182 |
atatcctccacaacaagtgcaagagattttgtcccctctggtaggttgtaccattctaatggtggtgatatgtttttctttgctccttgtccttcatcag |
5543083 |
T |
 |
| Q |
123 |
tgaattgtcttggtagttttccttcgtttgctattgctggtgacaccaacttgaacacttcacttccatcactagccatattgttgtttttctttagggt |
222 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5543082 |
tgaattgtcttggtagttttccttcgtttgctattgctggtgacaccaacttgaacacttcacttccatcactagccatattgttgtttttctttagggt |
5542983 |
T |
 |
| Q |
223 |
gttttttctctgcttct |
239 |
Q |
| |
|
||||||||| ||||||| |
|
|
| T |
5542982 |
gttttttctttgcttct |
5542966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University