View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11773_high_17 (Length: 234)
Name: NF11773_high_17
Description: NF11773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11773_high_17 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 20 - 216
Target Start/End: Original strand, 8792644 - 8792840
Alignment:
| Q |
20 |
tttaagtttatttgtcacacacaaagattttgaaggttatgatattatgatgtaagaagtaagcagaatctaatggtaaccatataagaaatttgtggct |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8792644 |
tttaagtttatttgtcacacacaaagattttgaaggttatgatattatgatgtaagaagtaagcagaatctaatggtaaccatataagaaatttgtggct |
8792743 |
T |
|
| Q |
120 |
tcagaatgctgatattagatggccatagatacgttaatccaacgtggcattatgtgatttgttttcattttgtgggaatggataatgtcttagctct |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8792744 |
tcagaatgctgatattagatggccatagatacgttaatccaacgtggcattatgtgatttgttttcattttgtgggaatggataatgtcttagctct |
8792840 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University