View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11773_low_15 (Length: 284)
Name: NF11773_low_15
Description: NF11773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11773_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 14 - 271
Target Start/End: Complemental strand, 40283698 - 40283440
Alignment:
| Q |
14 |
ggcatgcacgttgcagccctaca--tcaggattcaattgtgacagaaactccacttaattgtcttgaattgatttttgtggttgctgcacaaattatgct |
111 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40283698 |
ggcatgcactttgcagccctacacatcaggattcaattgtgacagaaactccactta-ttgtcttgaattgatttttgtggttgctgcacaaattatgct |
40283600 |
T |
 |
| Q |
112 |
ctagccaacaaaatttccatcatcattcatacaatacctcaaagtccccaacaactcatcaaggcatagcaaaccaggacaagactaagtatatgaggca |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40283599 |
ctagccaacaaaatttccatcatcattcatacaatacctcaaagtccccaacaactcatcaaggcatagcaaaccaggacaagactaagtatatgaggca |
40283500 |
T |
 |
| Q |
212 |
attaaatacaagaccacagcctttgtagcatcattcactcaccacaaaactaaacaagaa |
271 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||| |||||||||| ||||| |
|
|
| T |
40283499 |
attaaatacaagaccactgctcttgtagcatcattcactcatagcaaaactaaataagaa |
40283440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University