View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11773_low_23 (Length: 220)
Name: NF11773_low_23
Description: NF11773
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11773_low_23 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 220
Target Start/End: Original strand, 31589384 - 31589607
Alignment:
| Q |
1 |
gaacagaagatctctcttggcaaaatcaaaatattgtccgccagtcaccaaaaatacaaaaccgcaggcaacatttgttttctccttttccacttagcac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31589384 |
gaacagaagatctctcttggcaaaatcaaaatattgtccgccagtcaccaaaaatacaaaaccgcaggcaacatttgttttctccttttccacttagcac |
31589483 |
T |
 |
| Q |
101 |
ccagctttcttcactgattgatgcttcacctacaaatt----acacggtattcttcacgcataaagcttagttagctctctgcatgtggtgtggtctcgt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31589484 |
ccagctttcttcactgattgatgcttcacctacaaattgaacacatggtattcttcacgcataaagcttagttagctctctgcatgtggtgtggtctcgt |
31589583 |
T |
 |
| Q |
197 |
cttttctttgtcaaccttgtttgc |
220 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
31589584 |
cttttctttgtcaaccttgtttgc |
31589607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University