View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11774_high_3 (Length: 360)
Name: NF11774_high_3
Description: NF11774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11774_high_3 |
 |  |
|
| [»] scaffold0188 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr5 (Bit Score: 340; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 340; E-Value: 0
Query Start/End: Original strand, 1 - 344
Target Start/End: Original strand, 32932968 - 32933311
Alignment:
| Q |
1 |
tcttggtgaagttttgaacggtgatagattagttgttgctccttacaaacttgaattcttgattgataaaaaacctgagagcatttgccaaaagatgctg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32932968 |
tcttggtgaagttttgaacggtgatagattagttgttgctccttacaaacttgaattcttgattgataaaaaacctgagagcatttgccaaaagatgctg |
32933067 |
T |
 |
| Q |
101 |
acaagaaaagaggttgctcaattcagacacgctgttttgaaggactatttttatcaaatgtactatgatgacttgccaatttggggtttccttggaagat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32933068 |
acaagaaaagaggttgctcaattcagacacgctgttttgaaggactatttttatcaaatgtactatgatgacttgccaatttggggtttccttggaagat |
32933167 |
T |
 |
| Q |
201 |
ttgaaactgatgaaaaagatgttgacacaaatgaggccacagtttatctttttagaaatgttcattttgagattctgtacaataacgatcgtattatcga |
300 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32933168 |
ttgaaactgatgaaaaagatgttgacacaaacgaggccacagtttatctttttagaaatgttcattttgagattctgtacaataacgatcgtattatcga |
32933267 |
T |
 |
| Q |
301 |
tgttttcgttaaaaatgatccgaatgctgttgtggacttgacag |
344 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32933268 |
tgttttcgttaaaaatgatccgaatgctgttgtggacttgacag |
32933311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0188 (Bit Score: 88; Significance: 3e-42; HSPs: 2)
Name: scaffold0188
Description:
Target: scaffold0188; HSP #1
Raw Score: 88; E-Value: 3e-42
Query Start/End: Original strand, 217 - 340
Target Start/End: Original strand, 16776 - 16899
Alignment:
| Q |
217 |
agatgttgacacaaatgaggccacagtttatctttttagaaatgttcattttgagattctgtacaataacgatcgtattatcgatgttttcgttaaaaat |
316 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||| ||| |||||||||||||| |||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
16776 |
agatgttgacacaaatgaggcaacagtttatctttttacgaattttcattttgagattttgtacaataacgatcgtattatcgatgtattcgttaaaaat |
16875 |
T |
 |
| Q |
317 |
gatccgaatgctgttgtggacttg |
340 |
Q |
| |
|
|||| ||| ||||| ||||||||| |
|
|
| T |
16876 |
gatctgaacgctgtcgtggacttg |
16899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0188; HSP #2
Raw Score: 49; E-Value: 6e-19
Query Start/End: Original strand, 20 - 80
Target Start/End: Original strand, 16718 - 16778
Alignment:
| Q |
20 |
ggtgatagattagttgttgctccttacaaacttgaattcttgattgataaaaaacctgaga |
80 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | |||||||||||||||||| |||||| |
|
|
| T |
16718 |
ggtgatagattagttgttgctccttacaaacttcatttcttgattgataaaaaatctgaga |
16778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University