View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11774_low_2 (Length: 531)
Name: NF11774_low_2
Description: NF11774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11774_low_2 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 449 - 514
Target Start/End: Original strand, 18568615 - 18568681
Alignment:
| Q |
449 |
tacaatactaggaaa-tgtgggactctttcaacatgtatattttccacaacatcaataatcttgatg |
514 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
18568615 |
tacaatactaggaaaatgtgggactctttcaacatgtatattttccgcaacatcaataatcttgatg |
18568681 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University