View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11774_low_2 (Length: 531)

Name: NF11774_low_2
Description: NF11774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11774_low_2
NF11774_low_2
[»] chr1 (1 HSPs)
chr1 (449-514)||(18568615-18568681)


Alignment Details
Target: chr1 (Bit Score: 55; Significance: 2e-22; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 2e-22
Query Start/End: Original strand, 449 - 514
Target Start/End: Original strand, 18568615 - 18568681
Alignment:
449 tacaatactaggaaa-tgtgggactctttcaacatgtatattttccacaacatcaataatcttgatg 514  Q
    ||||||||||||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||    
18568615 tacaatactaggaaaatgtgggactctttcaacatgtatattttccgcaacatcaataatcttgatg 18568681  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University