View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11774_low_6 (Length: 273)
Name: NF11774_low_6
Description: NF11774
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11774_low_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 241; Significance: 1e-133; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 241; E-Value: 1e-133
Query Start/End: Original strand, 1 - 260
Target Start/End: Original strand, 41734922 - 41735184
Alignment:
| Q |
1 |
aagcaaagggagaagagtgattattttcactaatagattttgcttcatcatattatgatcagtggcagattgaattggtgatgtcaagatggatggtaaa |
100 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41734922 |
aagccaagggagaagagtgattattttcactaatagattttgcttcatcatattatgatcagtggcagattgaattggtgatgtcaagatggatggtaaa |
41735021 |
T |
|
| Q |
101 |
agtgtataaatactctaccaaggttggcatatggtagattaccaatctg---attaggccaactatatattgaattggtgtgaagaatatatgactatcg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735022 |
agtgtataaatactctaccaaggttggcatatggtagattaccaatctgatcattaggccaactatatattgaattggtgtgaagaatatatgactatcg |
41735121 |
T |
|
| Q |
198 |
cccatcactagtgaaaaatgggaattacaagataaaagacattttcgcaattaaattgatgtc |
260 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41735122 |
cccatcactagtgcaaaatgggaattacaagataaaagacattttcgcaattaaattgatgtc |
41735184 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University