View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11776_high_18 (Length: 313)
Name: NF11776_high_18
Description: NF11776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11776_high_18 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 265; Significance: 1e-148; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 265; E-Value: 1e-148
Query Start/End: Original strand, 10 - 294
Target Start/End: Complemental strand, 39586697 - 39586413
Alignment:
| Q |
10 |
agaagcaaagggatttagggagatgattaaggagatggtatcgttgggtggttcgagtaatcctggtgaatttgttgggattttgaggtggttcgatttt |
109 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
39586697 |
agaagctaagggatttagggagatgattaaggagatggtatcgttgggtggttcgagtaatcctggtgaatttgttgggattttgaggtggtttgatttt |
39586598 |
T |
|
| Q |
110 |
ggtggttatgaaaagaagttgaaaaggattgcaagaagatttgatgggtttttgcagggtttgattgatgagcataggaggaagaaggagaaggggaata |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39586597 |
ggtggttatgaaaagaagttgaaaaggattgcaagaagatttgatgggtttttgcaaggtttgattgatgagcataggaggaagaaggagaaggggaata |
39586498 |
T |
|
| Q |
210 |
acatgattgatcatctcttgaacttgcaagaattatcgcagccggaatattatactgatcaaatcatcaaagggattgttctggt |
294 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39586497 |
acatgattgatcatctcttgaacttgcaagaattatcacagccggagtattatactgatcaaatcatcaaagggattgttctggt |
39586413 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University