View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11776_low_19 (Length: 304)
Name: NF11776_low_19
Description: NF11776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11776_low_19 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 201; Significance: 1e-110; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 201; E-Value: 1e-110
Query Start/End: Original strand, 1 - 262
Target Start/End: Complemental strand, 47893684 - 47893422
Alignment:
| Q |
1 |
gagaatggtacttcctcgtaatgtgttgtgttccactcagggattttaaggtttggaattttgatcatggtttcggatggattaaggaatggtgtatgag |
100 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47893684 |
gagaatgttacttcctcgtattgtgttgtgttccactcagggattttaaggtttggaattttgatcatggtttcggatggattaaggaatggtgtatgag |
47893585 |
T |
|
| Q |
101 |
tgagtgagaggagtaattgattgcagtgtgactcgtgtagctagctagctatatatagaaagaaatgaatatca--atg---ctatgcatgtggtttgaa |
195 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| | ||| ||||| |||||||||||| |
|
|
| T |
47893584 |
tgactgagaggagtaattgattgcagtgtgactcgtgtagcta----gctatatatagaaagaaatgaataatatcatgtgcctatgtatgtggtttgaa |
47893489 |
T |
|
| Q |
196 |
aaatttaactgtggtttgagtaagtctacttggcttgctttataatggtaattattggcttctacct |
262 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47893488 |
aaatttaactgtggtttgagtaagtctacttggcttgctttataatggtaattattggcttctacct |
47893422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University