View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11776_low_24 (Length: 265)
Name: NF11776_low_24
Description: NF11776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11776_low_24 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 252
Target Start/End: Complemental strand, 45065817 - 45065566
Alignment:
| Q |
1 |
aaaaacagcatgtggctaatgattatgcaaaacggcttgcaataggttacacagaggtgatacttatctatatctatattctctttgaaatttattttct |
100 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45065817 |
aaaaacagcatgtggccaatgattatgcaaaacggcttgcaataggttacacagaggtgatacttatctatatctatattctctttgaaatttattttct |
45065718 |
T |
 |
| Q |
101 |
tgcatataaactcaaaaaagtttttcaatttggtgtctaattcaggcagagaaaagtgtttcagcatcacttgctttcttgacagaggcagcaaccaaaa |
200 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45065717 |
tgcatataaactcaaaaaaaaatttcaatttggtgtccaattcaggccgagaaaagtgtttcagcatcacttgctttcttgacagaggcagcaaccaaaa |
45065618 |
T |
 |
| Q |
201 |
ccggtcataggactccacagattcaatttcaacaggcaagtagtgatgttct |
252 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45065617 |
ccggtcataggactccacagattcaatttcaacaggcaagtagtgatgttct |
45065566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University