View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11776_low_28 (Length: 259)
Name: NF11776_low_28
Description: NF11776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11776_low_28 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 166; Significance: 6e-89; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 166; E-Value: 6e-89
Query Start/End: Original strand, 42 - 244
Target Start/End: Original strand, 10595402 - 10595604
Alignment:
| Q |
42 |
aattgacatcaatcttgttattaatggtgcannnnnnnggctgcagagtttgtgctataataactttccaagatcagccagtgaaaatctagttctgtct |
141 |
Q |
| |
|
||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10595402 |
aattgacatcaatcttgttattaatggtgcatttttttggatgcagagtttgtgctataataactttccaagatcagccagtgaaaatctagttctgtct |
10595501 |
T |
 |
| Q |
142 |
gttcttggtaacctttccaaacaaacatgattcctggatacagaaacatggactcatacccatttcaaagaaaccaaataccattccctcattaccagca |
241 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| || || |
|
|
| T |
10595502 |
gttcttggtaacctttccaaacaaacatgattcctggatacagaaacatggactcatacccatttcaaagaaaccaaataccattcccttattatcacca |
10595601 |
T |
 |
| Q |
242 |
tcc |
244 |
Q |
| |
|
||| |
|
|
| T |
10595602 |
tcc |
10595604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University