View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11776_low_30 (Length: 249)
Name: NF11776_low_30
Description: NF11776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11776_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 178; Significance: 4e-96; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 178; E-Value: 4e-96
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 34932864 - 34932643
Alignment:
| Q |
1 |
cggaataactcctgcgcacatgttcgacaacattcctgtgtttaaagccgaggcaagcttttctggggcctgtagcaaatgctttcttttaattctagtt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34932864 |
cggaataactcctgcgcacatgttcgacaaccttcctgtgtttaaagccgaggcaagcttttctggggcctgtagcaaatgctttcttttgattctagtt |
34932765 |
T |
 |
| Q |
101 |
tcactattttagtttctttgtgcgtattctagttctttaatattacttactctttaaacccacaggatcccgaactggtatcgcttcagcaatggcttga |
200 |
Q |
| |
|
|||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||| || |||||| |
|
|
| T |
34932764 |
tcacaattttagattctttgtgcgtattctagttctttaatattacttactctttaaacccacaggatctcgaactggcatcgcttcagaaaatgcttga |
34932665 |
T |
 |
| Q |
201 |
tgaaatagaaagtgagaagaat |
222 |
Q |
| |
|
| |||||||| ||||||||||| |
|
|
| T |
34932664 |
taaaatagaatgtgagaagaat |
34932643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 86 - 160
Target Start/End: Complemental strand, 38648688 - 38648614
Alignment:
| Q |
86 |
cttttaattctagtttcactattttagtttctttgtgcgtattctagttctttaatattacttactctttaaacc |
160 |
Q |
| |
|
||||| |||| |||||||| |||||||||||||||| | |||| | ||||||||||||| ||| ||| |||||| |
|
|
| T |
38648688 |
cttttgattcaagtttcacaattttagtttctttgttcatatttgaattctttaatattaattaatctataaacc |
38648614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University