View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11776_low_37 (Length: 237)
Name: NF11776_low_37
Description: NF11776
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11776_low_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 2e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 2e-82
Query Start/End: Original strand, 14 - 213
Target Start/End: Complemental strand, 1307555 - 1307354
Alignment:
| Q |
14 |
caaaggcagtacacatttcaatcaagtccattaatattcaaaattattatgactctatgcacaaaataacctataactaaatatttaactcaacacacta |
113 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
1307555 |
caaaggcagtacacatttcaatcaagtccattaatattcaaaattattatgactctatgcacaaaataacctataactaaatagttaactcaacacacta |
1307456 |
T |
|
| Q |
114 |
taaaaattactac--nnnnnnnnctagaccgaaatcaagttcataaacattcaaattaacaccaaacagtgtgtttctactacaactattcacctaaaca |
211 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
1307455 |
taaaaattactacaaaaaaaaaactagaccgaaatcaagttcataaacattgaaattaacaccaaacagtgtgtttctactacaaatattcacctaaaca |
1307356 |
T |
|
| Q |
212 |
ct |
213 |
Q |
| |
|
|| |
|
|
| T |
1307355 |
ct |
1307354 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 177
Target Start/End: Complemental strand, 1307321 - 1307287
Alignment:
| Q |
143 |
aaatcaagttcataaacattcaaattaacaccaaa |
177 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| |
|
|
| T |
1307321 |
aaatcaagttcataaacgttcaaattaacaccaaa |
1307287 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University