View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11777_high_5 (Length: 242)
Name: NF11777_high_5
Description: NF11777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11777_high_5 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 20 - 228
Target Start/End: Original strand, 8717730 - 8717936
Alignment:
| Q |
20 |
aaaacgacattggacatgatcaacctgaagcttttgaagaggacagtgctgatgattcttcgttcgttgattcaattttgaacgatggtgtttcaattag |
119 |
Q |
| |
|
|||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8717730 |
aaaacggcattggacacgatcaacctgaagcttttgaagaggacagtgctgatgattcttcgttcgttgattcaattttgaacgatggtgtttcaattag |
8717829 |
T |
 |
| Q |
120 |
tgaagaaacaagttaaactctacctgcttttttaatgattccactttataatagtctttaaattagtgagtggtgtacccatagtcgtgtagatactgta |
219 |
Q |
| |
|
| |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
8717830 |
taaagaaacaagttaaactcaacctgcttttttaatgattccactttataatagtctttaaatta--gagtggtgtacctgtagtcgtgtagatactgta |
8717927 |
T |
 |
| Q |
220 |
cctatgcta |
228 |
Q |
| |
|
||||||||| |
|
|
| T |
8717928 |
cctatgcta |
8717936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University