View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11778_high_47 (Length: 249)

Name: NF11778_high_47
Description: NF11778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11778_high_47
NF11778_high_47
[»] chr4 (1 HSPs)
chr4 (19-244)||(1600609-1600834)
[»] chr3 (2 HSPs)
chr3 (33-80)||(13470583-13470630)
chr3 (35-80)||(51764291-51764336)
[»] chr1 (1 HSPs)
chr1 (33-80)||(19468350-19468397)
[»] chr7 (1 HSPs)
chr7 (33-78)||(10614794-10614839)
[»] chr8 (2 HSPs)
chr8 (35-76)||(17627911-17627952)
chr8 (32-76)||(32151501-32151545)
[»] chr6 (1 HSPs)
chr6 (33-74)||(6410207-6410248)


Alignment Details
Target: chr4 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 19 - 244
Target Start/End: Original strand, 1600609 - 1600834
Alignment:
19 gttaatgcaactgctcaaatcaagcagttgaaaattgggaaaattggaagcaaacattatgacctttgtatcttgtaacacataattgttagccaaacgt 118  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
1600609 gttaatgcaactgctcaaatcaagcagttgcaaattgggaaaattggaagcaaacattatgatctttgtatcttgtaacacataattgttagccaaacgt 1600708  T
119 agacacttgatttgagggtttacaacacaattccctactctttcatatgcaatatttgcgcatgccattacgatctcattaagtaaaggacacttctcat 218  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
1600709 agacacttgatttgagggtttacaacacaattccctactctttcatatgcaatatttgcgcatgccattacgatctcattaagtaaaggacacttctcat 1600808  T
219 tgagtgcaaacaaggctgattctgtg 244  Q
    ||||||||||||||||||||||||||    
1600809 tgagtgcaaacaaggctgattctgtg 1600834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 80
Target Start/End: Complemental strand, 13470630 - 13470583
Alignment:
33 tcaaatcaagcagttgaaaattgggaaaattggaagcaaacattatga 80  Q
    ||||||||||||| || |||||||| ||||||||||||||||||||||    
13470630 tcaaatcaagcagctgcaaattggggaaattggaagcaaacattatga 13470583  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 35 - 80
Target Start/End: Complemental strand, 51764336 - 51764291
Alignment:
35 aaatcaagcagttgaaaattgggaaaattggaagcaaacattatga 80  Q
    ||||||||||| || |||||||| ||| ||||||||||||||||||    
51764336 aaatcaagcagctgcaaattggggaaaatggaagcaaacattatga 51764291  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 33 - 80
Target Start/End: Complemental strand, 19468397 - 19468350
Alignment:
33 tcaaatcaagcagttgaaaattgggaaaattggaagcaaacattatga 80  Q
    ||||||||||||| || |||||||||||| ||||||||||||||||||    
19468397 tcaaatcaagcagctgcaaattgggaaaaatggaagcaaacattatga 19468350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 33 - 78
Target Start/End: Original strand, 10614794 - 10614839
Alignment:
33 tcaaatcaagcagttgaaaattgggaaaattggaagcaaacattat 78  Q
    |||||||||||||||| |||||||| ||||||||||||||| ||||    
10614794 tcaaatcaagcagttgcaaattggggaaattggaagcaaactttat 10614839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 30; Significance: 0.00000008; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 35 - 76
Target Start/End: Complemental strand, 17627952 - 17627911
Alignment:
35 aaatcaagcagttgaaaattgggaaaattggaagcaaacatt 76  Q
    |||||||||||||| |||||||| ||| ||||||||||||||    
17627952 aaatcaagcagttgcaaattggggaaaatggaagcaaacatt 17627911  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 32 - 76
Target Start/End: Original strand, 32151501 - 32151545
Alignment:
32 ctcaaatcaagcagttgaaaattgggaaaattggaagcaaacatt 76  Q
    ||||||||||||||||| ||||| || ||| ||||||||||||||    
32151501 ctcaaatcaagcagttgcaaattagggaaaatggaagcaaacatt 32151545  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 33 - 74
Target Start/End: Original strand, 6410207 - 6410248
Alignment:
33 tcaaatcaagcagttgaaaattgggaaaattggaagcaaaca 74  Q
    |||||||||| ||||| |||||||||||| ||||||||||||    
6410207 tcaaatcaagtagttgtaaattgggaaaaatggaagcaaaca 6410248  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University