View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11778_low_38 (Length: 301)
Name: NF11778_low_38
Description: NF11778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11778_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 234; Significance: 1e-129; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 234; E-Value: 1e-129
Query Start/End: Original strand, 3 - 277
Target Start/End: Complemental strand, 20760842 - 20760572
Alignment:
| Q |
3 |
acggtaaacaacctagtttttctgtgtgaaaattcatcaattactaattagagaaacaattctttagagacaaatcttaattattttcatatccttgtta |
102 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
20760842 |
acggtaaacaacctagtttttctgtgtgaaaattcatcaattactaattagagaaacaattctttagagagaaactttaattattttcatatccttgtta |
20760743 |
T |
|
| Q |
103 |
ctctctatttgcatatatagaatactatgagaaaaccaaaattaattgggcaatatatttttcctctcaagtccgtttgtttaaaaccatcattagctag |
202 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
20760742 |
ctctctatttacata----gaatactatgagaaaaccaaaattaattgggcaatatatttttcctctcaagtcggtttgtttagaaccatcattagctag |
20760647 |
T |
|
| Q |
203 |
gttgtgaacgtttactcctattaaagtcttatacgcgtagaagaaaatgagtgttttaccaaaataagaatttga |
277 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20760646 |
gttgtgaacgtttactcctattaaagtcttatacgcgtagaagaaaatgagtgttttaccaaaataagaatttga |
20760572 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University