View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11778_low_40 (Length: 295)
Name: NF11778_low_40
Description: NF11778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11778_low_40 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 87; Significance: 1e-41; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 97 - 183
Target Start/End: Complemental strand, 31619512 - 31619426
Alignment:
| Q |
97 |
aaggtcgattgctcactctattttctccatcaaaatcaacatgagccgagcgtgttgctcaaaattggaaggcaatttcccttcatt |
183 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31619512 |
aaggtcgattgctcactctattttctccatcaaaatcaacatgagccgagcgtgttgctcaaaattggaaggcaatttcccttcatt |
31619426 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 86 - 141
Target Start/End: Complemental strand, 31586688 - 31586633
Alignment:
| Q |
86 |
ataatctcttcaaggtcgattgctcactctattttctccatcaaaatcaacatgag |
141 |
Q |
| |
|
|||||||||||||||| |||||| ||||| || ||||||||||||| |||||||| |
|
|
| T |
31586688 |
ataatctcttcaaggtgcattgctaactctgttctctccatcaaaattaacatgag |
31586633 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University