View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11778_low_42 (Length: 284)
Name: NF11778_low_42
Description: NF11778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11778_low_42 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 131; Significance: 5e-68; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 131; E-Value: 5e-68
Query Start/End: Original strand, 121 - 274
Target Start/End: Original strand, 11829955 - 11830109
Alignment:
| Q |
121 |
aaatatatgttggtgagaaatgatatttgtacaatgg-ataacttttagacaactaactgataaggtgaaaaccttatgcaagtcttaaaagctgtcata |
219 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
11829955 |
aaatacatgttggtgagaaatgatatttgtacaatgggataacttttagacaactaactgataaggtgaaaaccttctgcaagtcttaaaagctgtcata |
11830054 |
T |
|
| Q |
220 |
tatgcccacaaactttttaaaccaatcctacctaaaagaagccactgttttctca |
274 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||| |||||||||||||||||| |
|
|
| T |
11830055 |
tatgcccacaaactttttaaaccaatccttcctaaatgaagccactgttttctca |
11830109 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 25 - 90
Target Start/End: Original strand, 11829889 - 11829954
Alignment:
| Q |
25 |
aattagaggataaaattatattagtatgtttactatttttgaaaacacaatccaatagctggtgaa |
90 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
11829889 |
aattagaggatgaaattatattagtatgtttactatttttgaaaacaccatccaatagctggtgaa |
11829954 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University