View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11778_low_43 (Length: 273)
Name: NF11778_low_43
Description: NF11778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11778_low_43 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 8 - 263
Target Start/End: Original strand, 6418312 - 6418567
Alignment:
| Q |
8 |
cagtgatgagttgtttggtccattaaagaaaatactcgtgtatatcatttttgaagcttcaagtgcaggataatttaaattagatagtttcaagcatatc |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6418312 |
cagtgatgagttgtttggtccattaaagaaaatactcgtgtatatcattttttaagcttcaagtgcaggataatttaaattagatagtttcaagcatatc |
6418411 |
T |
 |
| Q |
108 |
ttggtttacttaatataacaannnnnnnnatttcttgtttaatgaagatatttcttgtttggctatggtgaacgttaacacattatatttatttgcaatt |
207 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
6418412 |
ttggtttacctaatataacaattttttttatttcttgtttaatgaagatatttcttgtttggctatggtgaacgttcacacattctatttatttgcaatt |
6418511 |
T |
 |
| Q |
208 |
tggtctcacgttagttggattatttgtgttgtgctcgggatgtacgttcttttact |
263 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6418512 |
tggtttcacgttagttggattatttgtgttgtgctcgggatgtacgttcttttact |
6418567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University