View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11778_low_51 (Length: 241)
Name: NF11778_low_51
Description: NF11778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11778_low_51 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 9 - 222
Target Start/End: Original strand, 10001656 - 10001870
Alignment:
| Q |
9 |
aatagttcttttgattcacgatacgaatctc-aatgctcatagtaaggaggggtaatgtagagcagtaaaatcactaaccttagtttcaggatcattcaa |
107 |
Q |
| |
|
||||||| ||| |||||| |||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10001656 |
aatagttatttcgattcatgatacgaatctctaatgctcatattaaggaggggtaatgtagagcagtaaaatcactaaccttagtttcaggatcattcaa |
10001755 |
T |
 |
| Q |
108 |
ctcaaccaataattctgcaacagtatctttacaaaagccacaactatttccatgaacctgtgaagaaatcgttgcagactcacaaaggtggtacttttca |
207 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10001756 |
ctcaactaataattctgcaacagtatctttacaaaagccacaactatttccatgaacctgtgaagaaatcgttgcagactcacaaaggtggtacttttca |
10001855 |
T |
 |
| Q |
208 |
cagagttctgcaggc |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
10001856 |
cagagttctgcaggc |
10001870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University