View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11778_low_67 (Length: 205)
Name: NF11778_low_67
Description: NF11778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11778_low_67 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 189
Target Start/End: Original strand, 3592305 - 3592493
Alignment:
| Q |
1 |
aactatggtgatgaagagtttaaaataatggaggagtcaactattaacaacagtgcaatgccaagcactagtgggagtggcactattacacagccatggg |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3592305 |
aactatggtgatgaagagtttaaaataatggaggagtcaactattaacaacagtgcaatgccaagcactagtggtagtggcactattacacagccatggg |
3592404 |
T |
 |
| Q |
101 |
agatacctgcaacaagtagtggaatggatatgtcaaactattggagttgggaggatattgattctttggtctcaactgatctaaatgtt |
189 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3592405 |
agatacctgcaacaagtagtggaatggatatgtcaaactattggagttgggaggatattgattctttggtctcaactgatctaaatgtt |
3592493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 110 - 185
Target Start/End: Original strand, 35722336 - 35722411
Alignment:
| Q |
110 |
caacaagtagtggaatggatatgtcaaactattggagttgggaggatattgattctttggtctcaactgatctaaa |
185 |
Q |
| |
|
|||||||| |||| ||||| | ||||| ||||||| |||||| || |||||||| ||||| |||||||||||||| |
|
|
| T |
35722336 |
caacaagtggtggcatggaaagttcaaagtattggaattgggaagacattgattcattggtttcaactgatctaaa |
35722411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University