View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11778_low_68 (Length: 205)
Name: NF11778_low_68
Description: NF11778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11778_low_68 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 1 - 164
Target Start/End: Complemental strand, 3592329 - 3592166
Alignment:
| Q |
1 |
ttttaaactcttcatcaccatagttatatccattagttgaccttaaagtgcttgagtttgagaatgggaatataaagctttggttttgatgaaagggcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3592329 |
ttttaaactcttcatcaccatagttatatccattatttgaccttaaagtgcttgagtttgagaatgggaatataaagctttggttttgatgaaagggcat |
3592230 |
T |
 |
| Q |
101 |
agatgaactcagaaacatgccattaccaataccaaactcttcattattaccttctgattgatct |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3592229 |
agatgaactcagaaacatgccattaccaataccaaactcttcattattaccttctgattgatct |
3592166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University