View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11779_high_2 (Length: 260)
Name: NF11779_high_2
Description: NF11779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11779_high_2 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 20 - 245
Target Start/End: Complemental strand, 45725671 - 45725446
Alignment:
| Q |
20 |
taaatagcttagttcttttaatttacataagcaaacaaacctctcatattcatacgtctagagcatatctgctgtgcagtttgatttacatcctcactag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45725671 |
taaatagcttagttcttttaatttacataagcaaacaaacctctcatattcatacgtctagagcatatctgctgtgcagtttgatttacatcctcactag |
45725572 |
T |
|
| Q |
120 |
ttagattgttatgtatatggttgagaagaggagaggtatgtggtgctgcacgagaagcattccgaactgaagagattttccccttagatatgacataaac |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45725571 |
ttagattgttatgtatatggttgagaagaggagaggtatgtggtgctgcacgagaagcattccgaactgaagagattttccccttagatatgacataaac |
45725472 |
T |
|
| Q |
220 |
agtacagaagtctggtgccccctttg |
245 |
Q |
| |
|
|||||||||||||||||||||||||| |
|
|
| T |
45725471 |
agtacagaagtctggtgccccctttg |
45725446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University