View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11779_low_8 (Length: 242)
Name: NF11779_low_8
Description: NF11779
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11779_low_8 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 3)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 98 - 226
Target Start/End: Original strand, 49568034 - 49568162
Alignment:
| Q |
98 |
ttgttattatgctgtagatagatcatcggttaatttgcacacccctactcatagtggacnnnnnnngtggcttttaagaatcaacgatggaatgagattg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
49568034 |
ttgttattatgctgtagatagatcatcggttaatttgcacacccctactcatagtggactttttttgtggcttttaagaatcaacgatggaatgagattg |
49568133 |
T |
|
| Q |
198 |
tattttgttttttctttcaaagtaccata |
226 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
49568134 |
tattttgttttttctttcaaagtaccata |
49568162 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 31 - 95
Target Start/End: Original strand, 49567939 - 49568003
Alignment:
| Q |
31 |
ggtgtttgtgagtatttataagagtggaatagggaagtctctcgctcaataaaataacacaactt |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49567939 |
ggtgtttgtgagtatttataagagtggaatagggaagtctctcgctcaataaaataacacaactt |
49568003 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 35; E-Value: 0.00000000008
Query Start/End: Original strand, 1 - 35
Target Start/End: Original strand, 49567835 - 49567869
Alignment:
| Q |
1 |
tttttgacagtacccgtgagatctcaatttggtgt |
35 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
49567835 |
tttttgacagtacccgtgagatctcaatttggtgt |
49567869 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University