View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11780_high_36 (Length: 340)
Name: NF11780_high_36
Description: NF11780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11780_high_36 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 66 - 322
Target Start/End: Complemental strand, 12834719 - 12834457
Alignment:
| Q |
66 |
gtaacatttagaaggactaataatttatttaacccaatttaaaaaa-ccattttcatttgtcgtttgttaggccagccacttttgcataaacaagcttca |
164 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
12834719 |
gtaacatttagaaggactaataatttatttaacccaattaaaaaaaaccattttcatttgtcgtttgttaggccagccatttttgcataaacaagcttca |
12834620 |
T |
|
| Q |
165 |
gagaggtgacaatccaccacttgcatgtgtgtgcatatatatctgtgtctgtgggtataaaccaattcattgcaccgctgataccaatacggcaatacta |
264 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12834619 |
gagaggtgacaatccaccacttgcatgtgtgtgcatatatatctgtgtctgtgggaataaaccaattcattgcaccgctgataccaatacggcaatacta |
12834520 |
T |
|
| Q |
265 |
atactagtactc-----tttgcatcttctcgcttggatctccatagccatctgatgagattcc |
322 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12834519 |
atactagtactctttaatttgcatcttctcgcttggatctccatagccatctgatgagattcc |
12834457 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University