View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11780_high_37 (Length: 325)
Name: NF11780_high_37
Description: NF11780
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11780_high_37 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 14 - 307
Target Start/End: Original strand, 48153484 - 48153786
Alignment:
| Q |
14 |
agacgggttcaattggtggtagaggtgtatcatagcgcctacgaacacgaccacgcccaccacggccccttccaccagcaaggtgagcttgatcggcttc |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48153484 |
agacgggttcaattggtggtagaggtgtatcatagcgcctacgaacacgaccacgcccaccacggccccttccaccagcaaggtgagcttgatcggcttc |
48153583 |
T |
 |
| Q |
114 |
tggatgttgcggatatggtccctcaaccacaggcataagaacatgaccacgcccatgc---------ccacggccccttcggccagcaaggtgagcttga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
48153584 |
tggatgttgcggatatggtccctcaaccacaggcataagaacatgaccacgcccatgcccacggccaccacggccccttcggccagcaaggtgagcttga |
48153683 |
T |
 |
| Q |
205 |
tcagcttctgccacatgcattggagcagttcgatatccacttcataataaagagaaacttcagacataatgtacagaataatttgacataagcaggagta |
304 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48153684 |
tcagcttctgccacatgcattggagcagttcgatatccacttcataacaaagagaaacttcagacataatgtacagaataatttgacataagcaggagta |
48153783 |
T |
 |
| Q |
305 |
ttt |
307 |
Q |
| |
|
||| |
|
|
| T |
48153784 |
ttt |
48153786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University